pcdna3 1 zeo expression vector (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
99
Structured Review
Thermo Fisher
pcdna3 1 zeo expression vector
Pcdna3 1 Zeo Expression Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/expression+vector+pcdna3+1+zeo/Zeocin/pm41390560-150-188-192
Average 99 stars, based on 1 article reviews
Pcdna3 1 Zeo Expression Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/expression+vector+pcdna3+1+zeo/Zeocin/pm41390560-150-188-192
Average 99 stars, based on 1 article reviews
pcdna3 1 zeo expression vector - by Bioz Stars,
2026-10
99/100 stars
Images
Related Articles
Produced:Article Title: Evolution of Hominin Detoxification: Neanderthal and Modern Human Ah Receptor Respond Similarly to TCDD Article Snippet: .. The synthetic modern human and Altai-Neanderthal cDNA sequences were produced including 5′-terminal Pst I and 3′-terminal Xho I restriction sites which were used to insert them into the Article Title: Evolution of hominin detoxification: Neanderthal and modern human AHR respond similarly to TCDD Article Snippet: .. The synthetic modern human and Altai-Neanderthal cDNA sequences were produced including 5’-terminal PstI and 3’-terminal XhoI restriction sites which were used to insert them into the Expressing:Article Title: Evolution of Hominin Detoxification: Neanderthal and Modern Human Ah Receptor Respond Similarly to TCDD Article Snippet: .. The synthetic modern human and Altai-Neanderthal cDNA sequences were produced including 5′-terminal Pst I and 3′-terminal Xho I restriction sites which were used to insert them into the Article Title: Role of thyroid transcription factor-1 in transcriptional regulation of heme oxygenase-1. Article Snippet: Here, we report thyroid transcription factor 1 (TTF-1) as an important transcription factor for the expression of heme oxygenase-1 (HO-1).. HO-1 is a well-known cytoprotective enzyme against inflammation.. We observed that HO-1 co-expressed with TTF-1 in mouse hypothalamic cells. Article Title: Defective interplay between mTORC1 activity and endoplasmic reticulum stress-unfolded protein response in uremic vascular calcification. Article Snippet: .. MOVAS cells were transfected with RAGE cDNA (MR206306; Origene) in the Article Title: 9-O-Acetylation of sialic acids is catalysed by CASD1 via a covalent acetyl-enzyme intermediate. Article Snippet: To generate constructs encoding a soluble Fc-chimera of BCoV-HE, DNA encoding the ectodomain (residues 1-388) of BCoV-HE (accession no. AAL57307) was generated by gene synthesis (Eurofins MWG Operon) and subsequent amplification by PCR using the primers 50-GACTGCTAGCATGTTTTTGCTTC CTAGATTTG-30 and 50-GACTGGATCCACTTACCTGTATCATACACACA AATAGGTAC-30 containing NheI and BamHI restriction sites (underlined), respectively. .. The resulting PCR fragment was ligated into the HindIII and NotI sites of the Article Title: EML4-ALK fusion gene Article Snippet: To 4 mg of the supernatant obtained after centrifugation, anti-EML4 antibody (Cell Signaling Inc.) was added and reacted overnight at 4° C. Then, protein G beads (Protein G Sepharose 4 Fast Flow; GE Healthcare Inc.) were added and immunoprecipitation was carried out for 2 hours. .. Also, EML4-ALKv2/pCR2.1 was digested with restriction enzyme HindIII and XbaI, the EML4-ALK fusion polynucleotide v2 was excised and inserted to the HindIII/XbaI site of an Article Title: Evolution of hominin detoxification: Neanderthal and modern human AHR respond similarly to TCDD Article Snippet: .. The synthetic modern human and Altai-Neanderthal cDNA sequences were produced including 5’-terminal PstI and 3’-terminal XhoI restriction sites which were used to insert them into the Article Title: A recombinant antibody fragment directed to the thymic stromal lymphopoietin receptor (CRLF2) efficiently targets pediatric Philadelphia chromosome-like acute lymphoblastic leukemia. Article Snippet: Antibody fragments are promising building blocks for developing targeted therapeutics, thus improving treatment efficacy while minimising off-target toxicity.. Despite recent advances in targeted therapeutics, patients with Philadelphia-like acute lymphoblastic leukemia (Ph-like ALL), a high-risk malignancy, lack specific and effective targeted treatments.. Cytokine receptor-like factor 2 (CRLF2) is overexpressed in 50% of Ph-like ALL cases, conferring the survival of leukemia blasts through activation of the JAK/STAT signalling pathway. Plasmid Preparation:Article Title: Evolution of Hominin Detoxification: Neanderthal and Modern Human Ah Receptor Respond Similarly to TCDD Article Snippet: .. The synthetic modern human and Altai-Neanderthal cDNA sequences were produced including 5′-terminal Pst I and 3′-terminal Xho I restriction sites which were used to insert them into the Article Title: Role of thyroid transcription factor-1 in transcriptional regulation of heme oxygenase-1. Article Snippet: Here, we report thyroid transcription factor 1 (TTF-1) as an important transcription factor for the expression of heme oxygenase-1 (HO-1).. HO-1 is a well-known cytoprotective enzyme against inflammation.. We observed that HO-1 co-expressed with TTF-1 in mouse hypothalamic cells. Article Title: Defective interplay between mTORC1 activity and endoplasmic reticulum stress-unfolded protein response in uremic vascular calcification. Article Snippet: .. MOVAS cells were transfected with RAGE cDNA (MR206306; Origene) in the Article Title: 9-O-Acetylation of sialic acids is catalysed by CASD1 via a covalent acetyl-enzyme intermediate. Article Snippet: To generate constructs encoding a soluble Fc-chimera of BCoV-HE, DNA encoding the ectodomain (residues 1-388) of BCoV-HE (accession no. AAL57307) was generated by gene synthesis (Eurofins MWG Operon) and subsequent amplification by PCR using the primers 50-GACTGCTAGCATGTTTTTGCTTC CTAGATTTG-30 and 50-GACTGGATCCACTTACCTGTATCATACACACA AATAGGTAC-30 containing NheI and BamHI restriction sites (underlined), respectively. .. The resulting PCR fragment was ligated into the HindIII and NotI sites of the Article Title: EML4-ALK fusion gene Article Snippet: To 4 mg of the supernatant obtained after centrifugation, anti-EML4 antibody (Cell Signaling Inc.) was added and reacted overnight at 4° C. Then, protein G beads (Protein G Sepharose 4 Fast Flow; GE Healthcare Inc.) were added and immunoprecipitation was carried out for 2 hours. .. Also, EML4-ALKv2/pCR2.1 was digested with restriction enzyme HindIII and XbaI, the EML4-ALK fusion polynucleotide v2 was excised and inserted to the HindIII/XbaI site of an Article Title: Evolution of hominin detoxification: Neanderthal and modern human AHR respond similarly to TCDD Article Snippet: .. The synthetic modern human and Altai-Neanderthal cDNA sequences were produced including 5’-terminal PstI and 3’-terminal XhoI restriction sites which were used to insert them into the Article Title: A recombinant antibody fragment directed to the thymic stromal lymphopoietin receptor (CRLF2) efficiently targets pediatric Philadelphia chromosome-like acute lymphoblastic leukemia. Article Snippet: Antibody fragments are promising building blocks for developing targeted therapeutics, thus improving treatment efficacy while minimising off-target toxicity.. Despite recent advances in targeted therapeutics, patients with Philadelphia-like acute lymphoblastic leukemia (Ph-like ALL), a high-risk malignancy, lack specific and effective targeted treatments.. Cytokine receptor-like factor 2 (CRLF2) is overexpressed in 50% of Ph-like ALL cases, conferring the survival of leukemia blasts through activation of the JAK/STAT signalling pathway. Recombinant:Article Title: Evolution of Hominin Detoxification: Neanderthal and Modern Human Ah Receptor Respond Similarly to TCDD Article Snippet: .. The synthetic modern human and Altai-Neanderthal cDNA sequences were produced including 5′-terminal Pst I and 3′-terminal Xho I restriction sites which were used to insert them into the Article Title: Evolution of hominin detoxification: Neanderthal and modern human AHR respond similarly to TCDD Article Snippet: .. The synthetic modern human and Altai-Neanderthal cDNA sequences were produced including 5’-terminal PstI and 3’-terminal XhoI restriction sites which were used to insert them into the Transfection:Article Title: Role of thyroid transcription factor-1 in transcriptional regulation of heme oxygenase-1. Article Snippet: Here, we report thyroid transcription factor 1 (TTF-1) as an important transcription factor for the expression of heme oxygenase-1 (HO-1).. HO-1 is a well-known cytoprotective enzyme against inflammation.. We observed that HO-1 co-expressed with TTF-1 in mouse hypothalamic cells. Article Title: Defective interplay between mTORC1 activity and endoplasmic reticulum stress-unfolded protein response in uremic vascular calcification. Article Snippet: .. MOVAS cells were transfected with RAGE cDNA (MR206306; Origene) in the Article Title: EML4-ALK fusion gene Article Snippet: To 4 mg of the supernatant obtained after centrifugation, anti-EML4 antibody (Cell Signaling Inc.) was added and reacted overnight at 4° C. Then, protein G beads (Protein G Sepharose 4 Fast Flow; GE Healthcare Inc.) were added and immunoprecipitation was carried out for 2 hours. .. Also, EML4-ALKv2/pCR2.1 was digested with restriction enzyme HindIII and XbaI, the EML4-ALK fusion polynucleotide v2 was excised and inserted to the HindIII/XbaI site of an shRNA:Article Title: Role of thyroid transcription factor-1 in transcriptional regulation of heme oxygenase-1. Article Snippet: Here, we report thyroid transcription factor 1 (TTF-1) as an important transcription factor for the expression of heme oxygenase-1 (HO-1).. HO-1 is a well-known cytoprotective enzyme against inflammation.. We observed that HO-1 co-expressed with TTF-1 in mouse hypothalamic cells. other:Article Title: 9- O -Acetylation of sialic acids is catalysed by CASD1 via a covalent acetyl-enzyme intermediate Article Snippet: clone IRCMp5012B0613D, ImaGenes) using the primers 5′-GCT AAGCTT CGA ATGGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACG GGTACCAGCCCCTGCGGGCGGGC-3′ and 5′-GCT GCGGCCGC CTAGGAAGTGGGCTGGAGTG-3′ containing the sequence encoding the V5 epitope (bold), HindIII and NotI restriction sites (underlined). Polymerase Chain Reaction:Article Title: 9-O-Acetylation of sialic acids is catalysed by CASD1 via a covalent acetyl-enzyme intermediate. Article Snippet: To generate constructs encoding a soluble Fc-chimera of BCoV-HE, DNA encoding the ectodomain (residues 1-388) of BCoV-HE (accession no. AAL57307) was generated by gene synthesis (Eurofins MWG Operon) and subsequent amplification by PCR using the primers 50-GACTGCTAGCATGTTTTTGCTTC CTAGATTTG-30 and 50-GACTGGATCCACTTACCTGTATCATACACACA AATAGGTAC-30 containing NheI and BamHI restriction sites (underlined), respectively. .. The resulting PCR fragment was ligated into the HindIII and NotI sites of the Article Title: A recombinant antibody fragment directed to the thymic stromal lymphopoietin receptor (CRLF2) efficiently targets pediatric Philadelphia chromosome-like acute lymphoblastic leukemia. Article Snippet: Antibody fragments are promising building blocks for developing targeted therapeutics, thus improving treatment efficacy while minimising off-target toxicity.. Despite recent advances in targeted therapeutics, patients with Philadelphia-like acute lymphoblastic leukemia (Ph-like ALL), a high-risk malignancy, lack specific and effective targeted treatments.. Cytokine receptor-like factor 2 (CRLF2) is overexpressed in 50% of Ph-like ALL cases, conferring the survival of leukemia blasts through activation of the JAK/STAT signalling pathway. Modification:Article Title: EML4-ALK fusion gene Article Snippet: To 4 mg of the supernatant obtained after centrifugation, anti-EML4 antibody (Cell Signaling Inc.) was added and reacted overnight at 4° C. Then, protein G beads (Protein G Sepharose 4 Fast Flow; GE Healthcare Inc.) were added and immunoprecipitation was carried out for 2 hours. .. Also, EML4-ALKv2/pCR2.1 was digested with restriction enzyme HindIII and XbaI, the EML4-ALK fusion polynucleotide v2 was excised and inserted to the HindIII/XbaI site of an FLAG-tag:Article Title: EML4-ALK fusion gene Article Snippet: To 4 mg of the supernatant obtained after centrifugation, anti-EML4 antibody (Cell Signaling Inc.) was added and reacted overnight at 4° C. Then, protein G beads (Protein G Sepharose 4 Fast Flow; GE Healthcare Inc.) were added and immunoprecipitation was carried out for 2 hours. .. Also, EML4-ALKv2/pCR2.1 was digested with restriction enzyme HindIII and XbaI, the EML4-ALK fusion polynucleotide v2 was excised and inserted to the HindIII/XbaI site of an Activity Assay:Article Title: EML4-ALK fusion gene Article Snippet: To 4 mg of the supernatant obtained after centrifugation, anti-EML4 antibody (Cell Signaling Inc.) was added and reacted overnight at 4° C. Then, protein G beads (Protein G Sepharose 4 Fast Flow; GE Healthcare Inc.) were added and immunoprecipitation was carried out for 2 hours. .. Also, EML4-ALKv2/pCR2.1 was digested with restriction enzyme HindIII and XbaI, the EML4-ALK fusion polynucleotide v2 was excised and inserted to the HindIII/XbaI site of an Control:Article Title: EML4-ALK fusion gene Article Snippet: To 4 mg of the supernatant obtained after centrifugation, anti-EML4 antibody (Cell Signaling Inc.) was added and reacted overnight at 4° C. Then, protein G beads (Protein G Sepharose 4 Fast Flow; GE Healthcare Inc.) were added and immunoprecipitation was carried out for 2 hours. .. Also, EML4-ALKv2/pCR2.1 was digested with restriction enzyme HindIII and XbaI, the EML4-ALK fusion polynucleotide v2 was excised and inserted to the HindIII/XbaI site of an Construct:Article Title: A recombinant antibody fragment directed to the thymic stromal lymphopoietin receptor (CRLF2) efficiently targets pediatric Philadelphia chromosome-like acute lymphoblastic leukemia. Article Snippet: Antibody fragments are promising building blocks for developing targeted therapeutics, thus improving treatment efficacy while minimising off-target toxicity.. Despite recent advances in targeted therapeutics, patients with Philadelphia-like acute lymphoblastic leukemia (Ph-like ALL), a high-risk malignancy, lack specific and effective targeted treatments.. Cytokine receptor-like factor 2 (CRLF2) is overexpressed in 50% of Ph-like ALL cases, conferring the survival of leukemia blasts through activation of the JAK/STAT signalling pathway. Generated:Article Title: A recombinant antibody fragment directed to the thymic stromal lymphopoietin receptor (CRLF2) efficiently targets pediatric Philadelphia chromosome-like acute lymphoblastic leukemia. Article Snippet: Antibody fragments are promising building blocks for developing targeted therapeutics, thus improving treatment efficacy while minimising off-target toxicity.. Despite recent advances in targeted therapeutics, patients with Philadelphia-like acute lymphoblastic leukemia (Ph-like ALL), a high-risk malignancy, lack specific and effective targeted treatments.. Cytokine receptor-like factor 2 (CRLF2) is overexpressed in 50% of Ph-like ALL cases, conferring the survival of leukemia blasts through activation of the JAK/STAT signalling pathway. Cloning:Article Title: A recombinant antibody fragment directed to the thymic stromal lymphopoietin receptor (CRLF2) efficiently targets pediatric Philadelphia chromosome-like acute lymphoblastic leukemia. Article Snippet: Antibody fragments are promising building blocks for developing targeted therapeutics, thus improving treatment efficacy while minimising off-target toxicity.. Despite recent advances in targeted therapeutics, patients with Philadelphia-like acute lymphoblastic leukemia (Ph-like ALL), a high-risk malignancy, lack specific and effective targeted treatments.. Cytokine receptor-like factor 2 (CRLF2) is overexpressed in 50% of Ph-like ALL cases, conferring the survival of leukemia blasts through activation of the JAK/STAT signalling pathway. |